View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_high_17 (Length: 397)
Name: NF1389_high_17
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_high_17 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 134 - 397
Target Start/End: Original strand, 2672208 - 2672472
Alignment:
| Q |
134 |
tggatcgtcgtaggc-aagacattgttggttgaaagtctttcttttctttgtctgactagacgaaccgtatactgaagatgcagtaatcgatgaatcatc |
232 |
Q |
| |
|
||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2672208 |
tggattgtcgtaggctaatacattgttggttgaaagtctttcttttctttgtctgactagacgaaccgtatagtgaagatgcagtaatcgatgaatcatc |
2672307 |
T |
|
| Q |
233 |
catttatctgcttaaacaaaacagtaaatgtcaaaagtgataatataaataacaacattaaggctctttatggtaaatataccctatatgacagtgagat |
332 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2672308 |
catttatctgtttagacaaaacagtaaatgtcaaaagtgataatataaataacaacattaaggctctttatggtaaatatactctatatgacagtgagat |
2672407 |
T |
|
| Q |
333 |
aaggttgttatcaaacacatttcatttttatcaaagaattatatgaactagtacaataaattata |
397 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
2672408 |
aaggttgttaccaaacagatttcatttttatcaaacaagtatataaactagtacaataaattata |
2672472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University