View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_high_20 (Length: 335)
Name: NF1389_high_20
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 321
Target Start/End: Original strand, 30355630 - 30355949
Alignment:
| Q |
1 |
tctcgtgatttagcaagttggttgcctagtcgtgatggagttatggatctagttatccaaaagggtatgtgaaacggatgttgtcatgtctagtgacgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30355630 |
tctcgtgatttagcaagttggttgcctagtcgtgatggagttatggatctagttatccaaaagggtatgtgaaacggatgttgtcatgtctagtgacgtt |
30355729 |
T |
|
| Q |
101 |
ctcgttcttagattctttgattttattcagatttgttgtaatttacaagttttaggtttggcgtcttgatggcttaatgtgatttatcaaggggtttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30355730 |
ctcgttcttagattctttgattttattcagatttgttgtaatttacaagttttaggtttggcgtcttgatggcttaatgtgatttatcaaggggtttgtt |
30355829 |
T |
|
| Q |
201 |
ggtgtcatggtgcgtgaatcagtccatgttagcggccagttcattcctcgtagttcatatttgagatgtgaagagtaattgagagtgttatctatgactt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30355830 |
ggtgtcatggtgcgtgaatcagtccatgttagcggccagttcattcctcgtagttcata-ttgagatgtgaagagtaattgagagtgttatctatgactc |
30355928 |
T |
|
| Q |
301 |
gtcaatcaacttttatagagt |
321 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30355929 |
gtcaatcaacttttatagagt |
30355949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University