View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_high_28 (Length: 262)
Name: NF1389_high_28
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_high_28 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 30 - 262
Target Start/End: Complemental strand, 42072260 - 42072016
Alignment:
| Q |
30 |
tattcaacggttggatttgattttgtgtgtatggttagattgtgatgtttgagaaacaagacatgaaatgaggaatggaaaagaaaacgtcacatcttaa |
129 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42072260 |
tattcaacggttagatttgattttgtgtgtatggttagattgtgatgtttgagaaacaagacatgaaatgaggaatggaaaagaaaacgtcacatcttaa |
42072161 |
T |
 |
| Q |
130 |
tcctaacgagctttgtctcttttctaaatggaaaattcatggcttcagcacatgtgatgatg------------agtaattttaaaactatattaataat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
42072160 |
tcctaacgagctttgtctcttttctaaatggaaaattcatggcttcagcacatgtgatgatgagtagagggatgagtaattttaattccatattaataat |
42072061 |
T |
 |
| Q |
218 |
tgtacttcatgatcttaatggcaaaatcactttaaacagatatat |
262 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
42072060 |
tgtacttcatcatcttaatggcaaaatcactttaaacatatatat |
42072016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University