View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_high_29 (Length: 261)
Name: NF1389_high_29
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_high_29 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 184 - 261
Target Start/End: Complemental strand, 37263944 - 37263867
Alignment:
| Q |
184 |
taatgttcataatttgaagcgtgacattaaaatacatgtttgatatctcattaaatttgttaacgttatggtaatttt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37263944 |
taatgttcataatttgaagcgtgacattaaaatacatgtttgatatctcattaaatttgttaacattatggtaatttt |
37263867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 28 - 57
Target Start/End: Complemental strand, 37264102 - 37264073
Alignment:
| Q |
28 |
tataagttttgatttgattcaacgtatatg |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37264102 |
tataagttttgatttgattcaacgtatatg |
37264073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University