View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1389_high_29 (Length: 261)

Name: NF1389_high_29
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1389_high_29
NF1389_high_29
[»] chr2 (2 HSPs)
chr2 (184-261)||(37263867-37263944)
chr2 (28-57)||(37264073-37264102)


Alignment Details
Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 184 - 261
Target Start/End: Complemental strand, 37263944 - 37263867
Alignment:
184 taatgttcataatttgaagcgtgacattaaaatacatgtttgatatctcattaaatttgttaacgttatggtaatttt 261  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
37263944 taatgttcataatttgaagcgtgacattaaaatacatgtttgatatctcattaaatttgttaacattatggtaatttt 37263867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 28 - 57
Target Start/End: Complemental strand, 37264102 - 37264073
Alignment:
28 tataagttttgatttgattcaacgtatatg 57  Q
    ||||||||||||||||||||||||||||||    
37264102 tataagttttgatttgattcaacgtatatg 37264073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University