View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_high_31 (Length: 251)
Name: NF1389_high_31
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 30 - 245
Target Start/End: Complemental strand, 7401951 - 7401735
Alignment:
| Q |
30 |
actacagtttgaggtcaaactatatatcacttacaagcttagctataaagcttgaaactagttttcagataaaaa-gctttggtagattgattgctgcac |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7401951 |
actacagtttgaggtcaaactatatatcacttacaagcttagctataaagcttgaaactagttttcagataaaaaagctttggtagattgattgctgcac |
7401852 |
T |
 |
| Q |
129 |
tattactagcatgatctgataaaatatagcctactactaactcaaagcctggaaaaatctcttttcaggttacctttactttttagattgatagcattta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7401851 |
tattactagcatgatctgataaaatatagcctactactaactcaaagcctggaaaaatctcttttcaggttacctttactttttagattgatagcattta |
7401752 |
T |
 |
| Q |
229 |
ctaaagtgaagtgaatg |
245 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7401751 |
ctaaagtgaagtgaatg |
7401735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University