View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_high_46 (Length: 205)
Name: NF1389_high_46
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_high_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 30 - 192
Target Start/End: Complemental strand, 8248493 - 8248332
Alignment:
| Q |
30 |
gagaaggtggtgtcgtagttaaactgagtgacaagtgcggtggtggaagtgaaacgtgaaaaattctgagaaagaatttgaatagaaaatcatgaaaata |
129 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8248493 |
gagaaggtggtgtcgtagtgaaactgagtgacaagtgcggtggtggaagtgaaacgtgaaaaattctgagaaagaatttgaatagaaaatcatgaaatta |
8248394 |
T |
|
| Q |
130 |
cccccctcaatttctgctggaaaatcaattatgtccctgcactttaatggaaatcatgaattt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8248393 |
-ccccctcaatttctgctggaaaatcaattatgtccctgcactttaatggaaatcatgaattt |
8248332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 150 - 183
Target Start/End: Complemental strand, 119399 - 119366
Alignment:
| Q |
150 |
aaaatcaattatgtccctgcactttaatggaaat |
183 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
119399 |
aaaatcaattatgtccctgcactttattggaaat |
119366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University