View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_low_15 (Length: 452)
Name: NF1389_low_15
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 7e-47; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 7e-47
Query Start/End: Original strand, 214 - 309
Target Start/End: Original strand, 31112617 - 31112712
Alignment:
| Q |
214 |
tttgagatgctcaaatataagagttgttattgaaaacttaaaaaacaccgtaagatttctcaatagatttttggcagtgatatcatgtatatttaa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31112617 |
tttgagatgctcaaatataagagttgttattgaaaacttaaaaaacaccgtaagatttctcaatagatttttggcagtgatatcatgtatatttaa |
31112712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 11 - 113
Target Start/End: Original strand, 31112413 - 31112515
Alignment:
| Q |
11 |
agaatatagcaatcatgtagacaaagctatgcgattattcgattgagtacgaacgatccagagttcaaagtcaataattctaagttacgaaaatacctcc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31112413 |
agaaaatagcaatcatgtagacaaagctatgcgattattcgattgagtacgaacgatccagagttcaaagtcaataattctaagttacgaaaatacttcc |
31112512 |
T |
 |
| Q |
111 |
ttc |
113 |
Q |
| |
|
||| |
|
|
| T |
31112513 |
ttc |
31112515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 376 - 423
Target Start/End: Original strand, 31112778 - 31112825
Alignment:
| Q |
376 |
tagggaacctttagctcatttaatcatttcattctttaactacactac |
423 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31112778 |
tagggaacctttagctcatttaatcatttcattctttaactacactac |
31112825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University