View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_low_29 (Length: 265)
Name: NF1389_low_29
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 30 - 243
Target Start/End: Complemental strand, 15562734 - 15562523
Alignment:
| Q |
30 |
ggtccctttatattttagaagaatactttctttcggtgtgatattttaggataacataacaataaaatagagaaataaaaactcat-ggttcgatggatt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15562734 |
ggtccctttatattttagaagaatactttctttcggtgtgatattttaggataacataacaataaaatagagaaataaaaactcatgggttcgatggatt |
15562635 |
T |
 |
| Q |
129 |
gatacaagtggaaagggacttgaacttcttaaatatgtggttaggagttcgatttttgtctcttgcgtatgnnnnnnnnnnttaatttgcagatgaaaac |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||||||| |
|
|
| T |
15562634 |
gatacaagtggaaagggacttgaacttcttaaatatgtggttaggagttcgatttttgtctcttgcgtatg---aaaaaaatcaatttggagatgaaaac |
15562538 |
T |
 |
| Q |
229 |
tcaccttatgcaccc |
243 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
15562537 |
tcaccttatgcaccc |
15562523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University