View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_low_39 (Length: 251)
Name: NF1389_low_39
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 35492065 - 35491817
Alignment:
| Q |
1 |
cctcattttcctcctcaaataatgtagcattatgagatgataattataattctagcacattagtactgcttgatttcctcattgaagttaggtttttcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35492065 |
cctcattttcctcctcaaataatgttgcattatgagatgataattgtaattctagcacattagtactgcttgatttcctcattgaagttaggtttttcaa |
35491966 |
T |
 |
| Q |
101 |
caaatcagcaagagtaacca----tttttgcagatgatggatttattgattgaccgttactgtgtcctgttgcatctgaaatggttccgactacccttgt |
196 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35491965 |
caaatcagcaagagtaaccaaccatttttgcagatgatggatttattgattgaccgttactgtttcctgttgcatctgaaacggttccgactacccttgt |
35491866 |
T |
 |
| Q |
197 |
cgacgaggatgacggtgatgaccactcctggccttcctccctatgctac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35491865 |
cgacgaggatgacggtgatgaccactcctggccttcctccctaagctac |
35491817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University