View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_low_40 (Length: 251)
Name: NF1389_low_40
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 20070502 - 20070631
Alignment:
| Q |
1 |
tgaatgccttaaaat-gaagttataccacaattaaatgaccaacatacccacaatgactatagtcatttgtaagtcaactctacaagataataaatctgg |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20070502 |
tgaatgccttaaaattgaagttataccacaattaaatcaccaacatacccacaatgactatagtcatttgtaagtcaactctacaagataataaatctgg |
20070601 |
T |
 |
| Q |
100 |
agttgcaaaatactaacaagtctattacta |
129 |
Q |
| |
|
|||||||||||||||| || ||||| |||| |
|
|
| T |
20070602 |
agttgcaaaatactaataattctatcacta |
20070631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 128 - 238
Target Start/End: Original strand, 20071179 - 20071289
Alignment:
| Q |
128 |
tagctccactgccattcccatttgattggtaacttgattcctttctttgaatcttgtgaaatctgtgatcatggtgtttattgatttgtacattttgtcc |
227 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
20071179 |
tagctccactctcattcccatttgattggtaacctgattcctttctttgaatcttgtgaaatccatgatcatggtgtttatcgatttgtacattttgtcc |
20071278 |
T |
 |
| Q |
228 |
aacctttctct |
238 |
Q |
| |
|
||| ||||||| |
|
|
| T |
20071279 |
aacatttctct |
20071289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University