View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_low_43 (Length: 249)
Name: NF1389_low_43
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 80 - 232
Target Start/End: Original strand, 37596691 - 37596841
Alignment:
| Q |
80 |
tgaaattatttcttttttatttcttactttatgtgtttagttaactgagaaagtataatatgatttttccttttcacatttcaacttatatggaggaaaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37596691 |
tgaaattatttcttttttatttcttactttatgt--ttagttaactgagaaagtataatatgatttttccttttcacatttcaacttatatggaggaaaa |
37596788 |
T |
 |
| Q |
180 |
aattgctttgnnnnnnngaagtttccaagtttttaaaaagaatatcatttatt |
232 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37596789 |
aattgctttgtttttttgaagtttccaagtttttaaaaagaatatcagttatt |
37596841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 13 - 54
Target Start/End: Original strand, 37596661 - 37596702
Alignment:
| Q |
13 |
aatatgtcaaatcataagtaagctgatcaatgaaattatttc |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37596661 |
aatatgtcaaatcataagtaagctgatcaatgaaattatttc |
37596702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University