View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1389_low_45 (Length: 229)
Name: NF1389_low_45
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1389_low_45 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 55118163 - 55118386
Alignment:
| Q |
7 |
actacgatttgtaagttgattttgtgataaattaatttataacttatttaaatgtgnnnnnnnnnnn--actggaaggtgttgttacaaaatcttgttaa |
104 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
55118163 |
actacgatttgtaagttcattttgtgataaattaatttataacttatttaaatgtgtttttttttttttactggaaggtgttgttacaaaatcttgttaa |
55118262 |
T |
 |
| Q |
105 |
agtactttgtgcaatttgcagataaaacacatatgtgtatacattgataagtactcaagtgcttttcatccgtaggatttcatctttatttagaacgtag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55118263 |
agtactttgtgcaatttgcagataaaacacat-tgtgtagacattgataagtactcaagtgctttttatccgtaggatttcatctttatttagaacgtag |
55118361 |
T |
 |
| Q |
205 |
gtctactgttgtatttagaccttat |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
55118362 |
gtctactgttgtatttagaccttat |
55118386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University