View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1389_low_48 (Length: 212)

Name: NF1389_low_48
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1389_low_48
NF1389_low_48
[»] chr3 (1 HSPs)
chr3 (111-145)||(1158529-1158563)


Alignment Details
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 145
Target Start/End: Complemental strand, 1158563 - 1158529
Alignment:
111 gaaaagaaagtagtatcagataaatggtctctgct 145  Q
    |||||||||||||||||||||||||||||| ||||    
1158563 gaaaagaaagtagtatcagataaatggtctttgct 1158529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University