View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-INSERTION-1 (Length: 264)
Name: NF1390-INSERTION-1
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390-INSERTION-1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 8 - 261
Target Start/End: Complemental strand, 35725036 - 35724789
Alignment:
| Q |
8 |
taggctacagcaatacctctagaatgccctctcaatactcatcaaaacctaacagnnnnnnnnnntctcctctgannnnnnnnnnatttaattctattta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |||| |
|
|
| T |
35725036 |
taggctacagcaatacctctagaatgccctctcaatactcatcaaaacctaacagaaaaaaaaaatctcctctgatttttttt--atttaattcttttta |
35724939 |
T |
 |
| Q |
108 |
agtgcatttaaattaacttgacttatgggtatagtaagtatccaccnnnnnnnaatgcatgaatatccaaaaattctccttctagttctagttatgaatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35724938 |
agtgcatttaaattaacttgacttatgggtatagta----tccacctttttttaatgcatgaatatccaaaaattctccttctagttctagttatcaatc |
35724843 |
T |
 |
| Q |
208 |
aaatggtaggcattcacctagactagatgaatttgttgcattgcatgcaccatg |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35724842 |
aaatggtaggcattcacctagactagatgaatttgttgcattgcatgcaccatg |
35724789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University