View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-19 (Length: 183)
Name: NF1390-Insertion-19
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390-Insertion-19 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 7 - 183
Target Start/End: Complemental strand, 16941163 - 16940988
Alignment:
| Q |
7 |
aggtatttatataaagtgtagtgtgtcaagattgataattattatgaatgtgacaaataaaattggtcttatcgtaaggatttggctcataccctactaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
16941163 |
aggtatttatataaagtgtagtgtgtcaagattgataattattatgaatgtgacaaataaaattggtcttatcgtaaggatttggctcataccttac-aa |
16941065 |
T |
 |
| Q |
107 |
aggttaaaggagtttagttatatttttatcttccgttgtcgtcgtttgaattttgtttatggataatgtgtaagtaa |
183 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16941064 |
aggtcaaaggagtttggttatatttttatcttccgttgtcgtcgtttgaattttgtttatggataatgtgtaagtaa |
16940988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 7 - 183
Target Start/End: Complemental strand, 17011828 - 17011653
Alignment:
| Q |
7 |
aggtatttatataaagtgtagtgtgtcaagattgataattattatgaatgtgacaaataaaattggtcttatcgtaaggatttggctcataccctactaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
17011828 |
aggtatttatataaagtgtagtgtgtcaagattgataattattatgaatgtgacaaataaaattggtcttatcgtaaggatttggctcataccttac-aa |
17011730 |
T |
 |
| Q |
107 |
aggttaaaggagtttagttatatttttatcttccgttgtcgtcgtttgaattttgtttatggataatgtgtaagtaa |
183 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17011729 |
aggtcaaaggagtttggttatatttttatcttccgttgtcgtcgtttgaattttgtttatggataatgtgtaagtaa |
17011653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University