View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-37 (Length: 348)
Name: NF1390-Insertion-37
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390-Insertion-37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 8 - 347
Target Start/End: Complemental strand, 315819 - 315483
Alignment:
| Q |
8 |
attcataacccctaactcatgctaaatttaaggaataaactgaatgggaccatacagtcataataaaacatgcatgccatgagtgtttgtccttgtgaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
315819 |
attcataacccctaactcatgctaaatttaaggaataaactgaatgggaccatacagtcataataaaacatgcatgccatgagtgtttgtccttgtgaaa |
315720 |
T |
 |
| Q |
108 |
gggaaaacatttgccttgcatatgaaggataagattaaaagtacgtacggtgcaatgctcatgtcttgatgaaatcatacataacgaattcactattgca |
207 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
315719 |
gggcaaacatttgccttgcatatgaaggataagattaaaagtacgtacggtgcaatgctcatgtcttgatgaaatcatacataacaaattcacaattgca |
315620 |
T |
 |
| Q |
208 |
ttccgtctagagaacacgctccaatcatttggaaacatagtgcatcgtgtcatgtcaatctaagggcagcactcgagtgatattgggggtcaatatcatg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
315619 |
ttccgtctagagaacacgctccaatcatttggaaacatagtgcatcgtgtcatgtcaatctaagggcagcactcgggtgatattggttgtcaatatcatg |
315520 |
T |
 |
| Q |
308 |
tgacattggcaacaaccacaatgttataagtgactttctt |
347 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
315519 |
tgacattgg---caaccacaatgttataagtggctttctt |
315483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University