View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390-Insertion-42 (Length: 153)
Name: NF1390-Insertion-42
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390-Insertion-42 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 7e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 7e-69
Query Start/End: Original strand, 7 - 153
Target Start/End: Original strand, 8059301 - 8059448
Alignment:
Q |
7 |
attttagacaccaaataagaagatcca-caaggtcactacttctacaaatatcaatatcactccaaatatcttcatctaccacatcaagattcttatcat |
105 |
Q |
|
|
||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
8059301 |
attttagacaccaaataagaagatccaacaaggttactacttctacaaatatcaatatcactccaaatatcttcatccaccacatcaagattcttatcat |
8059400 |
T |
|
Q |
106 |
tgaacaaaaccgttgctgcactagaagtgtaaaccacttttttcactg |
153 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8059401 |
tgaacaaaaccgttgctgcactagaagtgtaaaccacttttttcactg |
8059448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13911 times since January 2019
Visitors: 1255