View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390-Insertion-48 (Length: 276)

Name: NF1390-Insertion-48
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390-Insertion-48
NF1390-Insertion-48
[»] chr7 (2 HSPs)
chr7 (224-276)||(11478645-11478697)
chr7 (170-220)||(11478730-11478780)


Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 11478697 - 11478645
Alignment:
224 ccattgaatgcagaggaagcaatggatactgaagcttatggaatgctacggga 276  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
11478697 ccattgaatgcagaggaagcaatggatactgaagcttatggaatgctacggga 11478645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 170 - 220
Target Start/End: Complemental strand, 11478780 - 11478730
Alignment:
170 atccatccatgcatatatcaatctatctggtttgattcttttggatatgat 220  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||    
11478780 atccatcaatgcatatatcaatctatctggtttgattcttttggatatgat 11478730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University