View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13900_high_18 (Length: 346)
Name: NF13900_high_18
Description: NF13900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13900_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 23 - 336
Target Start/End: Original strand, 28053949 - 28054262
Alignment:
| Q |
23 |
tgctggtgttgatgatgacggcggcggtgatggtgatggctgtgtcgtttatcaaccaaccaatcacaaaacgctgcaatttgcttctgttcatttcgaa |
122 |
Q |
| |
|
|||||||||||||||||||| | ||| | || ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053949 |
tgctggtgttgatgatgacgatgacggcggtgatgatggctgtgtcttttatcaaccaaccaatcacaaaacgctgcaatttgcttctgttcatttcgaa |
28054048 |
T |
 |
| Q |
123 |
actttttaccaagttccgaaaccgcagagttttttgcgagattgtctttggtaggagtgtttgaacttttcggcaggtcgttttcaatgcaaaaagtcgt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
28054049 |
actttttaccaagttccgaaaccgcagagttttttgcgagattgactttggtaggagtgtttgaacttttcggcacgtcgttttcagtgcaaaaagtcgt |
28054148 |
T |
 |
| Q |
223 |
atccgtagatttgactggagattttttgttctcgtgatctaatgtactactctttgaagattcatcgaaccttttctctggaaattgcctaggaaaaaag |
322 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28054149 |
atccgtagatttgactggagattttttcttctcgtgatctaatgtactactctttgaagattcatcgaaccttttctctggaaattgcctaggaaaaaag |
28054248 |
T |
 |
| Q |
323 |
taagttgctctgtg |
336 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28054249 |
taagttgctctgtg |
28054262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University