View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13900_high_25 (Length: 279)
Name: NF13900_high_25
Description: NF13900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13900_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 257
Target Start/End: Complemental strand, 37835283 - 37835043
Alignment:
| Q |
17 |
cacagaaatggaaacttcccaatcgtctaatcttcatccacatagttaccatattcatttgcaaactaacggtgctcaagcatcagaatgtgaagaagct |
116 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37835283 |
cacagaaatggaaacttctcgatcgtctaatcttcatccacatagttaccatattcatttgcaaactaacggtgctcaagcatcagaatgtgaagaagct |
37835184 |
T |
 |
| Q |
117 |
gaattaggtatatttttcttgggcttccctcattctatttaaagatttgaaatgttttacttttgcgctaagagaacattttgaataacctttttatgct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37835183 |
gaattaggtatatttttcttgggcttccctcattctatttaaagatttgaaatgttttacttttgcgctaagagaacattttgaataacctttttatgct |
37835084 |
T |
 |
| Q |
217 |
tttattcttcgttcactttttctgtgtatctattttaacat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37835083 |
tttattcttcgttcactttttctgtgtatctattttaacat |
37835043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University