View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13900_high_26 (Length: 267)
Name: NF13900_high_26
Description: NF13900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13900_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 13 - 251
Target Start/End: Complemental strand, 21994227 - 21993987
Alignment:
| Q |
13 |
aatataatggatgtggagtagacagctgcctatatggatttcattggctgtcattgattgatctttggtgtctta--gttcttttctctcttaataaatc |
110 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||| |||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
21994227 |
aatataatggatgtggaggagacaccgacctatatgaatttcattgggtgtcattgattgatctttggtgtcttatagttcttatctctcttaataaatc |
21994128 |
T |
|
| Q |
111 |
attctctttcaagtgaaatccggagagatcacaaacattaaaatttatgatagtgcttaaattgtttatattgatatttgacaaccannnnnnnnnaggt |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21994127 |
attctctttcaagtgaaattcggagagatcacaaacattaaaatttatgatattgcttaaattgtttatattgatatttgacaaccatttttttttaggt |
21994028 |
T |
|
| Q |
211 |
gagaaccatagacttatacaattaattgaatctaaataatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21994027 |
gagaaccatagacttatacaattaattgaatctaaataatt |
21993987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University