View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13900_low_30 (Length: 251)
Name: NF13900_low_30
Description: NF13900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13900_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 54392308 - 54392179
Alignment:
| Q |
1 |
tggcgtttaggatggacccatacatgtattggtccatattggatcaagatttttgaccattaaattacacaagtttatagatcttaccatgcattcgctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| ||| |
|
|
| T |
54392308 |
tggcgtttaggatggacccatacatgtattggtccatattggatcaagatttctgaccattaaattacacaagcttatagatcttaccatgtattcactc |
54392209 |
T |
 |
| Q |
101 |
cattatatcggacttcttctactcatgaat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54392208 |
cattatatcggacttcttctactcatgaat |
54392179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 4 - 62
Target Start/End: Complemental strand, 52694809 - 52694751
Alignment:
| Q |
4 |
cgtttaggatggacccatacatgtattggtccatattggatcaagatttttgaccatta |
62 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
52694809 |
cgtttagcatggactcatagatgtattggtccatactggatcaagatttctgaccatta |
52694751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 6 - 109
Target Start/End: Original strand, 25376298 - 25376401
Alignment:
| Q |
6 |
tttaggatggacccatacatgtattggtccatattggatcaagatttttgaccattaaattacacaagtttatagatcttaccatgcattcgctccatta |
105 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||| |||| ||| |||| | |||||| |||| ||||| |||||||| || ||||||||| || || || |
|
|
| T |
25376298 |
tttagcatggactcatagatgtattggtccatactggaccaacatttctatccattagattaaacaagcttatagattctatcatgcattcactgcacta |
25376397 |
T |
 |
| Q |
106 |
tatc |
109 |
Q |
| |
|
|||| |
|
|
| T |
25376398 |
tatc |
25376401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 4 - 96
Target Start/End: Complemental strand, 22453664 - 22453572
Alignment:
| Q |
4 |
cgtttaggatggacccatacatgtattggtccatattggatcaagatttttgaccattaaattacacaagtttatagatcttaccatgcattc |
96 |
Q |
| |
|
||||||| ||| |||||| ||||||||||||| |||||| |||||||| ||||||||| |||| ||||||||||||||| || |||||||| |
|
|
| T |
22453664 |
cgtttagcatgcacccatggatgtattggtccagattggaccaagatttatgaccattagattatacaagtttatagatcctataatgcattc |
22453572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 4 - 62
Target Start/End: Original strand, 43038717 - 43038775
Alignment:
| Q |
4 |
cgtttaggatggacccatacatgtattggtccatattggatcaagatttttgaccatta |
62 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
43038717 |
cgtttagcatggactcatagatgtattggtccatactggatcaagatttctgaccatta |
43038775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 4 - 63
Target Start/End: Original strand, 22629206 - 22629265
Alignment:
| Q |
4 |
cgtttaggatggacccatacatgtattggtccatattggatcaagatttttgaccattaa |
63 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22629206 |
cgtttagcatggactcatagatgtattggtccatactggatcaagatttttgaccattaa |
22629265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University