View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13900_low_33 (Length: 245)
Name: NF13900_low_33
Description: NF13900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13900_low_33 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 69 - 245
Target Start/End: Original strand, 34911239 - 34911415
Alignment:
| Q |
69 |
agtaatttttagaattagtaataataggacatcgtaatttcttaaacaaataaaaatagggttaggatgatataaaatttttaggacatcataataaaat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
34911239 |
agtaatttttagaattagtaataataggacatcgtaatttcttaaacaaataaaaatagggttaagatgatataaaaattttaggacatcataataaaat |
34911338 |
T |
|
| Q |
169 |
agaaatattttatctcgcatcgagctggtattcagaaaatgaatttttctttaattaactttatatttaatgtgaat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34911339 |
agaaatattttatctcgcatcgagctggtattcagaaaatgaatttttctttaattaactttatatttaatgtgaat |
34911415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 34911041 - 34911095
Alignment:
| Q |
18 |
ggaagggacccaaatagtatttttagtctacaaagtaattttacaccgaatagta |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34911041 |
ggaagggacccaaatagtatttttagtctacaaagtaattttacacgaaatagta |
34911095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University