View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13900_low_34 (Length: 243)
Name: NF13900_low_34
Description: NF13900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13900_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 34911409 - 34911643
Alignment:
| Q |
1 |
tgtgaatttctatgataaaatatttaaattattagaatttttatgtatagtacctcattgagagagcttgccaacttttagaaaatctcaccactatcgg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34911409 |
tgtgaatttctatgagaaaatatttaaattattagaatttttatgtatagtacctcattgagagagcttgccaacttttagaaaatctcaccactaccgg |
34911508 |
T |
|
| Q |
101 |
cgaagttgacgatatgtagatctcaattttcatagccaaaacctcgtggattccgaggatgttgcggtgagtaggaaggtagtggataagtttgattttg |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||| |
|
|
| T |
34911509 |
cgaagttgacgatatgcagatctcaattttcatagccaaaacctcgtggattccgaggatgttgcggtgagtagg-agataggggataagtttgattttg |
34911607 |
T |
|
| Q |
201 |
caaatgatttactgctccattgatgcgtccatcgtt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34911608 |
caaatgatttactgctccattgatgcgtccatcgtt |
34911643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University