View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13900_low_37 (Length: 227)
Name: NF13900_low_37
Description: NF13900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13900_low_37 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 19185187 - 19184961
Alignment:
| Q |
1 |
gtatgggtttgatttggttcttccatgattcaagagattgatcaagaagtatagttgggttttctgcatacaatggaggattttcaaatattttttgaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19185187 |
gtatgggtttgatttggttcttccatgattcaagagattgatcaagaagtatagttgggttttctggatacaatggaggattttcaaatattttttgaag |
19185088 |
T |
 |
| Q |
101 |
gctgcatgttgacatgatcgatggcgaatatgttggattcgatgatcgatattcctaggttttgatctagggttgatgttgttagagagaaagaaaaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19185087 |
gctgcatgttgacatgatcgatggctaatatgttggatttgatgatcgatattcctaggttttgatctagggttgatgttgttagagagaaagaaaaaca |
19184988 |
T |
 |
| Q |
201 |
aaacatatatattaggattcgatgatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
19184987 |
aaacatatatattaggattcgatgatt |
19184961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 135 - 211
Target Start/End: Complemental strand, 19184973 - 19184887
Alignment:
| Q |
135 |
ggattcgatgatcgatattcctaggttttgatctagggttgatgtt----------gttagagagaaagaaaaacaaaacatatata |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19184973 |
ggattcgatgattgatattcctaggttttgatctagggttgatgtttttctcataggttagagagaaagaaaaacaaaacatatata |
19184887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University