View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13900_low_6 (Length: 613)

Name: NF13900_low_6
Description: NF13900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13900_low_6
NF13900_low_6
[»] chr7 (1 HSPs)
chr7 (13-153)||(1579512-1579652)
[»] chr4 (3 HSPs)
chr4 (13-134)||(48847850-48847971)
chr4 (49-146)||(7588015-7588112)
chr4 (44-108)||(46784856-46784920)
[»] chr2 (2 HSPs)
chr2 (21-146)||(26790985-26791110)
chr2 (21-119)||(572883-572981)
[»] scaffold0214 (1 HSPs)
scaffold0214 (21-146)||(8631-8756)
[»] chr6 (2 HSPs)
chr6 (22-111)||(12646340-12646429)
chr6 (38-123)||(24894214-24894299)
[»] chr5 (1 HSPs)
chr5 (44-111)||(23621002-23621069)
[»] chr3 (1 HSPs)
chr3 (38-117)||(23424194-23424273)
[»] chr1 (1 HSPs)
chr1 (21-112)||(5193412-5193503)
[»] chr8 (1 HSPs)
chr8 (13-87)||(26586950-26587024)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 3e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 3e-59
Query Start/End: Original strand, 13 - 153
Target Start/End: Original strand, 1579512 - 1579652
Alignment:
13 aatattgctaagaataggtcacaggcgatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtg 112  Q
    |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
1579512 aatattgctaagaataggtctcagtcgatgaacaaggactttggtgatgattttgtagatgatattgcataggctaatggggcgaaagtctttgtaagtg 1579611  T
113 gtgggagggtcagccttgggtatgagggctatgaaagtgtc 153  Q
    ||||||||||| |||||||||||||||||||| | ||||||    
1579612 gtgggagggtccgccttgggtatgagggctataagagtgtc 1579652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 98; Significance: 6e-48; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 6e-48
Query Start/End: Original strand, 13 - 134
Target Start/End: Complemental strand, 48847971 - 48847850
Alignment:
13 aatattgctaagaataggtcacaggcgatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtg 112  Q
    |||||||||||||||||||   ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||    
48847971 aatattgctaagaataggtattaggcgatgaacaaggactttggtgatgattttgtagaagatgttgcataggctaatggggcaaaagtctttgtaagtg 48847872  T
113 gtgggagggtcagccttgggta 134  Q
    ||||||||||| ||||||||||    
48847871 gtgggagggtcggccttgggta 48847850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 49 - 146
Target Start/End: Original strand, 7588015 - 7588112
Alignment:
49 gactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtgggagggtcagccttgggtatgagggctatga 146  Q
    |||||||||||||| |||||| |  |||||||| ||||||||||| |||||||||||  | || |||||||||||||  ||||| |||||||| ||||    
7588015 gactttggtgatgagtttgtacacaatgttgcaaaggctaatgggtcgaaagtctttaaatgttgtgggagggtcagttttgggaatgagggcaatga 7588112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 44 - 108
Target Start/End: Original strand, 46784856 - 46784920
Alignment:
44 acaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgta 108  Q
    ||||||||||||||||||||||||||| | |||||||| ||||| || || | ||||||||||||    
46784856 acaaggactttggtgatgattttgtaggttatgttgcaaaggctgataggtctaaagtctttgta 46784920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 50; Significance: 3e-19; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 21 - 146
Target Start/End: Complemental strand, 26791110 - 26790985
Alignment:
21 taagaataggtcacaggcgatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtgggagg 120  Q
    |||| |||||||  |||||||| ||||||||||| ||||| ||||||||||||||||| || ||||||||||| | ||||||||| || ||    |||||    
26791110 taaggataggtctgaggcgatggacaaggactttagtgataattttgtagatgatgttacaaaggctaatgggtctaaagtctttataggttaaaggagg 26791011  T
121 gtcagccttgggtatgagggctatga 146  Q
    |||| | ||||| |||||||||||||    
26791010 gtcaactttgggaatgagggctatga 26790985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 21 - 119
Target Start/End: Complemental strand, 572981 - 572883
Alignment:
21 taagaataggtcacaggcgatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtgggag 119  Q
    ||||||||||||  || ||||| ||||| ||||| |||||||| ||||||||  | ||||| ||||| ||||| | ||| |||||||||||| ||||||    
572981 taagaataggtctaagacgatgcacaagaacttttgtgatgatattgtagatcgtattgcagaggctgatgggtctaaaatctttgtaagtgatgggag 572883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0214 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: scaffold0214
Description:

Target: scaffold0214; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 21 - 146
Target Start/End: Complemental strand, 8756 - 8631
Alignment:
21 taagaataggtcacaggcgatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtgggagg 120  Q
    |||| |||||||  ||||| || ||||| || || ||||| ||||||||||||||||| || ||||||||||| | |||||||||| | ||   ||||||    
8756 taaggataggtctgaggcggtggacaagaaccttagtgataattttgtagatgatgttacaaaggctaatgggtctaaagtctttgaaggttaagggagg 8657  T
121 gtcagccttgggtatgagggctatga 146  Q
    |||| | ||||| || ||||||||||    
8656 gtcaactttggggataagggctatga 8631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 38; Significance: 0.000000000004; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 22 - 111
Target Start/End: Original strand, 12646340 - 12646429
Alignment:
22 aagaataggtcacaggcgatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagt 111  Q
    |||||| ||||  |||||| | |||||||||||||| |||||||||||||  |||||||| ||||||||||| |  || |||||||||||    
12646340 aagaatcggtctgaggcgaaggacaaggactttggtaatgattttgtagacaatgttgcaaaggctaatgggtctgaaatctttgtaagt 12646429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 38 - 123
Target Start/End: Original strand, 24894214 - 24894299
Alignment:
38 cgatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtgggagggtc 123  Q
    ||||| ||||| ||||| | ||| || |||||||| ||||||||||| || ||||| | ||| |||||| |||||||||| |||||    
24894214 cgatgcacaagaactttagggataatcttgtagattatgttgcatagactgatgggtctaaaatctttgaaagtggtgggggggtc 24894299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 44 - 111
Target Start/End: Original strand, 23621002 - 23621069
Alignment:
44 acaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagt 111  Q
    |||||||||||||| || ||||||||||| |||||||| ||||| ||||| || || |||||||||||    
23621002 acaaggactttggtaataattttgtagattatgttgcaaaggcttatgggacggaaatctttgtaagt 23621069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 38 - 117
Target Start/End: Complemental strand, 23424273 - 23424194
Alignment:
38 cgatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtggtggg 117  Q
    ||||| ||||| ||||| ||||| || |||||||| ||||||||||| || ||||| | ||| |||||||||||||||||    
23424273 cgatgcacaagaactttagtgataatcttgtagattatgttgcatagacttatgggtctaaaatctttgtaagtggtggg 23424194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 21 - 112
Target Start/End: Original strand, 5193412 - 5193503
Alignment:
21 taagaataggtcacaggcgatgaacaaggactttggtgatgattttgtagatgatgttgcataggctaatggggcgaaagtctttgtaagtg 112  Q
    ||||||||||||  || ||||| ||||| ||||| ||||| || |||||||| |||||||| ||||| ||||| | ||| ||||||||||||    
5193412 taagaataggtctgagacgatgcacaagaacttttgtgataatcttgtagattatgttgcagaggctgatgggtctaaaatctttgtaagtg 5193503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 13 - 87
Target Start/End: Complemental strand, 26587024 - 26586950
Alignment:
13 aatattgctaagaataggtcacaggcgatgaacaaggactttggtgatgattttgtagatgatgttgcataggct 87  Q
    ||||||| |||| || ||||  |||||||| ||||||||||||||||||||||| ||| | |||||||| |||||    
26587024 aatattgttaaggatcggtctgaggcgatggacaaggactttggtgatgattttataggttatgttgcagaggct 26586950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University