View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13901_high_11 (Length: 211)
Name: NF13901_high_11
Description: NF13901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13901_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 52785168 - 52785361
Alignment:
| Q |
1 |
taggggaaggtatgaatggtggtgttggctcgtagtatggtgttg---gctcaaaataaggtgggctcatcgatggcccaggtggacctggaaaaatgat |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52785168 |
taggggaaggtatgaatggtggtgttggctcgtagtatggtggagcgggctcaaaataaggtgggctcatcgatggcccgggtggacctggaaaaatgat |
52785267 |
T |
 |
| Q |
98 |
ggggggattcagtataggctctggtgagcctggtatgttactgggtgggcttggaacaatttcaggtgttggtgttggaaagttttccggtggg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
52785268 |
ggggggattcagtataggctctggtgagcctggtatgttactgggtgggcttggaacaatttcaggtgttggtgttggaaagttatctggtggg |
52785361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 52785356 - 52785406
Alignment:
| Q |
141 |
ggtgggcttggaacaatttcaggtgttggtgttggaaagttttccggtggg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52785356 |
ggtgggcttggaacaatttcaggtgttggtgttggaaagttttccggtggg |
52785406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University