View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13901_low_11 (Length: 211)

Name: NF13901_low_11
Description: NF13901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13901_low_11
NF13901_low_11
[»] chr1 (2 HSPs)
chr1 (1-191)||(52785168-52785361)
chr1 (141-191)||(52785356-52785406)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 52785168 - 52785361
Alignment:
1 taggggaaggtatgaatggtggtgttggctcgtagtatggtgttg---gctcaaaataaggtgggctcatcgatggcccaggtggacctggaaaaatgat 97  Q
    ||||||||||||||||||||||||||||||||||||||||||  |   ||||||||||||||||||||||||||||||| ||||||||||||||||||||    
52785168 taggggaaggtatgaatggtggtgttggctcgtagtatggtggagcgggctcaaaataaggtgggctcatcgatggcccgggtggacctggaaaaatgat 52785267  T
98 ggggggattcagtataggctctggtgagcctggtatgttactgggtgggcttggaacaatttcaggtgttggtgttggaaagttttccggtggg 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||    
52785268 ggggggattcagtataggctctggtgagcctggtatgttactgggtgggcttggaacaatttcaggtgttggtgttggaaagttatctggtggg 52785361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 52785356 - 52785406
Alignment:
141 ggtgggcttggaacaatttcaggtgttggtgttggaaagttttccggtggg 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
52785356 ggtgggcttggaacaatttcaggtgttggtgttggaaagttttccggtggg 52785406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University