View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13902_high_7 (Length: 223)
Name: NF13902_high_7
Description: NF13902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13902_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 13 - 202
Target Start/End: Complemental strand, 37597024 - 37596835
Alignment:
| Q |
13 |
catcaatgaacggtggtggcttgtttcggaaagtaggaatttcaagtggatactttccttcattcatagtattcggtttgggaaatgccatagccatctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
37597024 |
catcaatgaacggtggtggcttgtttcggaaagtaggaatttcaagtggatactttccttcattcatagtattcggtttgggaaatgccaaagtcatctt |
37596925 |
T |
 |
| Q |
113 |
gtgaccttacatgcacaccattcacaccaatgcagccaattatcatctcacgtgcccatcaaattatatgtgagcagtagggggtcttga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||| || |||||| |
|
|
| T |
37596924 |
gtgaccttacatgcacaccattcacaccaatgcagccaattatcatctcacgtggccataaaattataaatgagcagtagcggatcttga |
37596835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University