View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13903_low_12 (Length: 262)
Name: NF13903_low_12
Description: NF13903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13903_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 9 - 209
Target Start/End: Complemental strand, 35376987 - 35376787
Alignment:
| Q |
9 |
tgttcaaataacacaactcttatttaaaggtgggatatggaaggaggactagtttttggagggagtgttggttcgaaaattcaccgttgtgcaagtagta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35376987 |
tgttcaaataacacaactcttatttaaaggtgggatatggaaggaggactagtttttggagggagtgttggttcgaaaattcaccgttgtgcaagtagta |
35376888 |
T |
|
| Q |
109 |
cccttgtctattctctctagcgacagacaaggatgcaaaggtggaggacgcgagtaagagaatgggttatttgtaggttgacttggtccttgaggagagg |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35376887 |
ccctcgtctattctctctagcgacagacaaggatgcaaaggtggaggatgtgagtaagagaatgagttatttgtaggtggacttggtccttgaggagagg |
35376788 |
T |
|
| Q |
209 |
g |
209 |
Q |
| |
|
| |
|
|
| T |
35376787 |
g |
35376787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 2 - 31
Target Start/End: Original strand, 9311199 - 9311228
Alignment:
| Q |
2 |
aaatgattgttcaaataacacaactcttat |
31 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9311199 |
aaatgattgttcaaataacacaactcttat |
9311228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 6522187 - 6522159
Alignment:
| Q |
1 |
taaatgattgttcaaataacacaactctt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6522187 |
taaatgattgttcaaataacacaactctt |
6522159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University