View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13903_low_12 (Length: 262)

Name: NF13903_low_12
Description: NF13903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13903_low_12
NF13903_low_12
[»] chr3 (2 HSPs)
chr3 (9-209)||(35376787-35376987)
chr3 (2-31)||(9311199-9311228)
[»] chr7 (1 HSPs)
chr7 (1-29)||(6522159-6522187)


Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 9 - 209
Target Start/End: Complemental strand, 35376987 - 35376787
Alignment:
9 tgttcaaataacacaactcttatttaaaggtgggatatggaaggaggactagtttttggagggagtgttggttcgaaaattcaccgttgtgcaagtagta 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35376987 tgttcaaataacacaactcttatttaaaggtgggatatggaaggaggactagtttttggagggagtgttggttcgaaaattcaccgttgtgcaagtagta 35376888  T
109 cccttgtctattctctctagcgacagacaaggatgcaaaggtggaggacgcgagtaagagaatgggttatttgtaggttgacttggtccttgaggagagg 208  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||| |||||||||||||||||||||    
35376887 ccctcgtctattctctctagcgacagacaaggatgcaaaggtggaggatgtgagtaagagaatgagttatttgtaggtggacttggtccttgaggagagg 35376788  T
209 g 209  Q
    |    
35376787 g 35376787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 2 - 31
Target Start/End: Original strand, 9311199 - 9311228
Alignment:
2 aaatgattgttcaaataacacaactcttat 31  Q
    ||||||||||||||||||||||||||||||    
9311199 aaatgattgttcaaataacacaactcttat 9311228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 6522187 - 6522159
Alignment:
1 taaatgattgttcaaataacacaactctt 29  Q
    |||||||||||||||||||||||||||||    
6522187 taaatgattgttcaaataacacaactctt 6522159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University