View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13903_low_14 (Length: 208)
Name: NF13903_low_14
Description: NF13903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13903_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 15 - 155
Target Start/End: Original strand, 968631 - 968771
Alignment:
| Q |
15 |
aatatataggccaaaagtcttgaattaaaaaataaaatatgggtggaagatcaaatatcaaggatggtgcagggttggtgtcaattgtttgtaacagaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
968631 |
aatatataggccaaaagtcttgaattaaaaaataaaatatgggtggaagatcaaatatcaaggatggtgcagggttggtgtcaattgtttgtaacagaca |
968730 |
T |
 |
| Q |
115 |
acaaagggataatgtgtttccttgtgtcaggaaggatatat |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
968731 |
acaaagggataatatgtttccttgtgtcaggaaggatatat |
968771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University