View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13904_high_11 (Length: 293)
Name: NF13904_high_11
Description: NF13904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13904_high_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 7 - 135
Target Start/End: Complemental strand, 13269761 - 13269629
Alignment:
| Q |
7 |
gcaacatcgttacaagacttaattgatcagtcttcgtagttgcactcg-aaggatacccgttttacacg---nnnnnnntatgttgtttccatggattat |
102 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||| |||||||||| ||||| ||||||| |||||| |
|
|
| T |
13269761 |
gcaacatcgttacaagacttaattgattagtcttcgcagttgcactcgaaaggatacctgttttacacggaaaaaaaagcatgttctttccatagattat |
13269662 |
T |
|
| Q |
103 |
ataattcttgtctcacaaatcacaatgcaattc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13269661 |
ataattcttgtctcacaaatcacaatgcaattc |
13269629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 280
Target Start/End: Complemental strand, 13269504 - 13269440
Alignment:
| Q |
221 |
gaacacatgtatacgacaatattgcaacattt-----atatcccttgttttacctaaattattat |
280 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13269504 |
gaacacatgtatacgacaatattgtaacatttatattatatcccttgttttacctaaattattat |
13269440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University