View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13904_low_11 (Length: 315)
Name: NF13904_low_11
Description: NF13904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13904_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 9e-64; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 14 - 141
Target Start/End: Original strand, 31792909 - 31793036
Alignment:
| Q |
14 |
ttcttcaatgcgtgaaggtggaagatggtcgggaacaaatatacacatcacatgcttctaccattttaacttgagagctgcatgtttgcacattatgctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31792909 |
ttcttcaatgcgtgaaggtggaagatggtcgggaacaaatatacacatcacatgcttctaccattttaacttgagagctgcatgtttgcacattatactt |
31793008 |
T |
 |
| Q |
114 |
acatgtctagaaatttgtaggacatagt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
31793009 |
acatgtctagaaatttgtaggacatagt |
31793036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 205 - 298
Target Start/End: Original strand, 31793100 - 31793191
Alignment:
| Q |
205 |
taatatgtcttggagatacgagtcgaacatttgatagagtggtaaatagatcattttctatatacaaaagttttctttttagattgttaaaaat |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31793100 |
taatatgtcttggagatacgagtcgaacatttgatagagtagtaaatagatcattttc--tatacaaaagttttctttttagattgttaaaaat |
31793191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 34 - 108
Target Start/End: Original strand, 31806273 - 31806348
Alignment:
| Q |
34 |
gaagatggtcgggaacaaatatacacatcacatgcttctaccattttaacttgagagctgcatgt-ttgcacatta |
108 |
Q |
| |
|
||||||| | |||||||||||||||||||| |||||||| |||| || |||| ||||||||||| |||||||||| |
|
|
| T |
31806273 |
gaagatgcttgggaacaaatatacacatcagatgcttcttccatcttgacttatgagctgcatgtcttgcacatta |
31806348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University