View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13904_low_14 (Length: 255)
Name: NF13904_low_14
Description: NF13904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13904_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 11 - 239
Target Start/End: Original strand, 34628954 - 34629182
Alignment:
| Q |
11 |
cacagacattgttgccccatttgatgcaactactcctttcatatttgaccatgcatattatggtaacttgcagaacaagatggggttgctagcatctgac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34628954 |
cacagacattgttgccccatttgatgcaactactcctttcatatttgaccatgcatattatggtaacttgcagaacaagatggggttgctagcatctgac |
34629053 |
T |
 |
| Q |
111 |
caagctttggctttggatccacgaaccaagtcactggttcaagattttgcaaaggataaacaaaagttttttcaagcttttgcatctgctatggacaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34629054 |
caagctttggctttggatccacgaaccaagtcactggttcaagattttgcaaaggataaacaaaagttttttcaagcttttgcatctgctatggacaaaa |
34629153 |
T |
 |
| Q |
211 |
tgagtttagtgaaagttttgagaggaaaa |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||| |
|
|
| T |
34629154 |
tgagtttagtgaaagttgtgagaggaaaa |
34629182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University