View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13904_low_15 (Length: 255)
Name: NF13904_low_15
Description: NF13904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13904_low_15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 6 - 255
Target Start/End: Original strand, 29105799 - 29106048
Alignment:
| Q |
6 |
caaaggaataccaaagagatagtaacatgcaatatttacataagcaacagctgattgccacccagcaccaatggcaacacctgaaagaactggctgaatg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29105799 |
caaaggaataccaaagagatagtaacatgcaatatttacataagcaacagctgattgccacccagcaccaatggcaacacctgaaagaacaggctgaatg |
29105898 |
T |
|
| Q |
106 |
ttgttgatgacaatgcataatgccaacattggtgtcaattcaatcactacctctctcacttctggatcatttgagaataatactggatactgttttcgga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29105899 |
ttgttgatgacaatgcataatgccaacattggtgtcaattcaatcactacctctctcacttctggatcatttgagaataatactggatactgttttcgga |
29105998 |
T |
|
| Q |
206 |
atattattaaaatcattgaaagaatgagaccaagggcaaatgatgtaatc |
255 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29105999 |
agattattaaaatcattgaaagaatgagaccaagggcaaatgatgtaatc |
29106048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University