View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13904_low_17 (Length: 252)
Name: NF13904_low_17
Description: NF13904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13904_low_17 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 252
Target Start/End: Complemental strand, 47686217 - 47685972
Alignment:
| Q |
14 |
atagtctatggcaaaaaagggagcactaacggtccggttagagtcccacattaaatgataatgaac-tgtttgatgacatacaaggtgagacctacctct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
47686217 |
atagtctatggcaaaaaagggagcactaacggtccggttagagtcccacattaaatgataatgaacctgtttgatgacatacaaggtgagacctaccact |
47686118 |
T |
|
| Q |
113 |
acttataaacatattttcagttttcatttcatttcat-----gtataactcttttaacactagttgtggcaatttattttaagttgtcaaaaaatctact |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47686117 |
acttataaacatattttcagttttcatttcatttcatttcatgtataactcttttaacactagttgtggcaatttattttaagttgtcaaaaaatctact |
47686018 |
T |
|
| Q |
208 |
aaactaggattaagacactagaaacat-aagagtttcatattcaac |
252 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47686017 |
aaactaggattaagacactagaaacataaagagtttcatattcaac |
47685972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University