View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13904_low_22 (Length: 244)
Name: NF13904_low_22
Description: NF13904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13904_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 48231677 - 48231446
Alignment:
| Q |
1 |
ctagaacaaaatggggatcagctccttgaggccccagatgttaacgctgagattatcccaaatgcagccattgatcagccccttgaggtcccaaatgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48231677 |
ctagaacaaaatggggatcagctccttgaggccccagatgttaacgctgagattatcccaaatgcagccattgatcagccccttgaggtcccaaatgtga |
48231578 |
T |
 |
| Q |
101 |
accctgagatcaaaaatgcagccgatgatcattcccctgagatcattgatgtcccctctgagctcattgatgtcaatgttgatatgcctaatgcatttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48231577 |
accctgagatcaaaaatgcagccgatgatcattcccctgagatcattgatgtcccctctgagctcattgatgtcaatgttgatatgcctaatgcatttaa |
48231478 |
T |
 |
| Q |
201 |
taagaagaggtctctagaggcgggggaggacg |
232 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
48231477 |
taagaagaggtctctagaggcgggtgaggacg |
48231446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 48236717 - 48236486
Alignment:
| Q |
1 |
ctagaacaaaatggggatcagctccttgaggccccagatgttaacgctgagattatcccaaatgcagccattgatcagccccttgaggtcccaaatgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236717 |
ctagaacaaaatggggatcagctccttgaggccccagatgttaacgctgagattatcccaaatgcagccattgatcagccccttgaggtcccaaatgtga |
48236618 |
T |
 |
| Q |
101 |
accctgagatcaaaaatgcagccgatgatcattcccctgagatcattgatgtcccctctgagctcattgatgtcaatgttgatatgcctaatgcatttaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236617 |
accctgagatcaaaaatgcagccgatgatcattcccctgagatcattgatgtcccctctgagctcattgatgtcaatgttgatatgcctaatgcatttaa |
48236518 |
T |
 |
| Q |
201 |
taagaagaggtctctagaggcgggggaggacg |
232 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
48236517 |
taagaagaggtctctagaggcgggtgaggacg |
48236486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University