View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13904_low_23 (Length: 244)
Name: NF13904_low_23
Description: NF13904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13904_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 38 - 232
Target Start/End: Complemental strand, 48231640 - 48231446
Alignment:
| Q |
38 |
atgttaacgctgagattatcccaaatgcagccattgatcagccccttgaggtcccaaatgtgaaccctgagatcaaaaatgcagccgatgatcattcccc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48231640 |
atgttaacgctgagattatcccaaatgcagccattgatcagccccttgaggtcccaaatgtgaaccctgagatcaaaaatgcagccgatgatcattcccc |
48231541 |
T |
|
| Q |
138 |
tgagatcattgatgtcccctctgagctcattgatgtcaatgttgatatgcctaatgcatttaataagaagaggtctctagaggcgggggaggacg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48231540 |
tgagatcattgatgtcccctctgagctcattgatgtcaatgttgatatgcctaatgcatttaataagaagaggtctctagaggcgggtgaggacg |
48231446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 38 - 232
Target Start/End: Complemental strand, 48236680 - 48236486
Alignment:
| Q |
38 |
atgttaacgctgagattatcccaaatgcagccattgatcagccccttgaggtcccaaatgtgaaccctgagatcaaaaatgcagccgatgatcattcccc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236680 |
atgttaacgctgagattatcccaaatgcagccattgatcagccccttgaggtcccaaatgtgaaccctgagatcaaaaatgcagccgatgatcattcccc |
48236581 |
T |
|
| Q |
138 |
tgagatcattgatgtcccctctgagctcattgatgtcaatgttgatatgcctaatgcatttaataagaagaggtctctagaggcgggggaggacg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48236580 |
tgagatcattgatgtcccctctgagctcattgatgtcaatgttgatatgcctaatgcatttaataagaagaggtctctagaggcgggtgaggacg |
48236486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 48231653 - 48231688
Alignment:
| Q |
1 |
ggagctgatccccattttgttctagtcgatatttca |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48231653 |
ggagctgatccccattttgttctagtcgatatttca |
48231688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 48236693 - 48236728
Alignment:
| Q |
1 |
ggagctgatccccattttgttctagtcgatatttca |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236693 |
ggagctgatccccattttgttctagtcgatatttca |
48236728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University