View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13904_low_29 (Length: 231)
Name: NF13904_low_29
Description: NF13904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13904_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 31279019 - 31278820
Alignment:
| Q |
18 |
agtggaatggtggaacaactcagtaattatgtgaaggtgcttcagcaagaaaattcatatctctttgaaatgcttttggagaagttggaagaatatatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31279019 |
agtggaatggtggaacaactcagtaattatgtgaaggtgcttcagcaagaaaattcatatctctttgaaatgcttttggagaagttggaagaatatatta |
31278920 |
T |
|
| Q |
118 |
gttatgattctggatttaaagtatctgagcccgatttcatgatcgaggccttgccaactgaaacaatcgacaaccttcacaaaacagccaagttgatggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31278919 |
gttatgattctggatttaaagtatctgagcccgatttcatgatcgaggccttgccaactgaaacaatcgacaaccttcacaaaacagccaagttgatggt |
31278820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 24 - 217
Target Start/End: Original strand, 31285283 - 31285476
Alignment:
| Q |
24 |
atggtggaacaactcagtaattatgtgaaggtgcttcagcaagaaaattcatatctctttgaaatgcttttggagaagttggaagaatatattagttatg |
123 |
Q |
| |
|
|||||||||||||| |||||| |||||| |||||| ||||||||||| ||||| | ||||||||||||||||||||| ||||||| || | ||| |
|
|
| T |
31285283 |
atggtggaacaactttctaattacatgaaggcacttcaggaagaaaattcaaatctcatcgaaatgcttttggagaagttgaaagaatactgtaatgatg |
31285382 |
T |
|
| Q |
124 |
attctggatttaaagtatctgagcccgatttcatgatcgaggccttgccaactgaaacaatcgacaaccttcacaaaacagccaagttgatggt |
217 |
Q |
| |
|
||||| ||||||| || ||||| ||||| || |||||| |||||||||||||||||||| | |||||| |||| ||||| || ||||||||||| |
|
|
| T |
31285383 |
attctagatttaatgtgtctgaccccgacttaatgatcaaggccttgccaactgaaacagtggacaacattcataaaactgcgaagttgatggt |
31285476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University