View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13904_low_6 (Length: 467)
Name: NF13904_low_6
Description: NF13904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13904_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 74 - 456
Target Start/End: Original strand, 41548014 - 41548396
Alignment:
| Q |
74 |
gaagattgttgtatgttactgatagatgaaccattgcgtcttcatttgaatctgttctcattgtttaccaattattactcctagggtttannnnnnnagt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41548014 |
gaagattgttgtatgttactgatagatgaaccattgcgtcttcgtttgaatctgttctcattgtttaccaattattactcctagggtttatttttttagt |
41548113 |
T |
 |
| Q |
174 |
actacatgcacttattctcccatttgacgaaatgattacagatattatcaattgattttccattttcgtttttaaaattacgatgatctatgccttcaca |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
41548114 |
actacatgcacttattctcccatttgacgaaatgattacagatattatcaatggattttccattttcgtttttaaaattaccatgatttatgccttcaca |
41548213 |
T |
 |
| Q |
274 |
gtaattgttgttgaatttaggccttattaatctcgtttctctgattttctcacaatttttgggatgtcctcctcatgtaagatatttcctcgcaatcaag |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41548214 |
gtaattgttgttgaatttaggccttattaatctcgtttctctgattttctcacaatttttgggatgtcctcctcatgtaagatatttcctcgcaatcaag |
41548313 |
T |
 |
| Q |
374 |
catggctgtgagggaaaaaatggattaatggaatgtgttgcgtgaacaaacaatatgatttgtcattcactttctttattcat |
456 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41548314 |
catggctgcgagggaaaaaatggattaatggaatgtgttgcgtgaacaaacaatatgatttgtcattcactttctttattcat |
41548396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University