View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13905_high_2 (Length: 710)
Name: NF13905_high_2
Description: NF13905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13905_high_2 |
 |  |
|
| [»] scaffold0490 (1 HSPs) |
 |  |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 633; Significance: 0; HSPs: 14)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 633; E-Value: 0
Query Start/End: Original strand, 19 - 703
Target Start/End: Original strand, 44816 - 45500
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctcaggacaattgttatgaacagtctatataattactaacatgttcaggaaatggtatatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44816 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctctggacaattgttatgagcagtctatataattactaacatgttcaggaaatggtatatg |
44915 |
T |
 |
| Q |
119 |
aaatttgatactgattagatgagttttgagccttcaaatgagatactaaagttgcacgctcttttttggaatttctgtgagaactgtttttgtctacaat |
218 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44916 |
aaatttgataccgattagatgagttttgagccttcaaatgagatactaaagttgcatgctcttttttggaatttctgtgagaactctttttgtctacaat |
45015 |
T |
 |
| Q |
219 |
tttatacactattctttgcgcaactaattcaaagtaaaagcacggatttgatgtatgatgtgttaggaatctgtctctattttttattgatattttcatg |
318 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45016 |
tttatacactattctgtgcgcaactaattcaaagtaaaagcacggatttgatgtatgatgtgttaggaatctgtctctattttttattgatattttcatg |
45115 |
T |
 |
| Q |
319 |
aaggtttgagtgccaaaagtggtgaacattgtatgatgttcatgctgaacattgttataaaagtcctctgttttgaattttcctagaccttttaatgatc |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45116 |
aaggtttgagtgccaaaagtggtgaacattgtatgatgttcgtgctgaacattgttataaaagtcctctgttttgaattttcctagatcttttaatgatc |
45215 |
T |
 |
| Q |
419 |
gtttttgataaaataacattacggtgatgattcattatgtgttgctggtttgcaacttttattggattttagatttaacttttggccttaacccatatag |
518 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
45216 |
gtttttgataaaataacattacggtgatgattcattatgtgttgctggttttcaacttttattggattttagatttaacttctggccttaacccatatgg |
45315 |
T |
 |
| Q |
519 |
gctgggtcaagtaggttggtcttgaccatactggcgactctaaatgtataacgccaacactttgttgaggagtttaattcagtctcactattgcagcttc |
618 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45316 |
gctgggtcaagtaggttggtcttgaccatactggcgactctaaatgtataaagccaacactttgttgaggagtttaattcagtctcactattgcagcttc |
45415 |
T |
 |
| Q |
619 |
taaagcctaaatgcttattgaattccattttgatgtttgatttgaatttctgagaaatagcttgccaatttgaaacctccctttg |
703 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45416 |
taaagcctaaatgcttattgaattccattttgatgtttgatttgaatttctgagaaatagcctgccaatttgaaacctccctttg |
45500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 21552648 - 21552685
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacag |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21552648 |
atgcatgaccttttgaactctatgtagaaggtcaacag |
21552685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 52741639 - 52741598
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52741639 |
atgcatgaccttttgaactctatgtagaaggtcaacaacctc |
52741598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 53785689 - 53785730
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53785689 |
atgcatgaccttttgaactctatgtagaaggtcaacaacctc |
53785730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 32546775 - 32546815
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcct |
59 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32546775 |
atgcatgactttttgaactctatgtagaaggtcaacagcct |
32546815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 26856889 - 26856852
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacag |
56 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26856889 |
atgcatgaccctttgaactctatgtagaaggtcaacag |
26856852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 37133126 - 37133085
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
37133126 |
atgcatgacctttagaactctatgtagaaggtcaacaacctc |
37133085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 44198747 - 44198788
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44198747 |
atgcataaccttctgaactctatgtagaaggtcaacagcctc |
44198788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 51234596 - 51234637
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
51234596 |
atgcataaccttttgaactctatgtagaaggtcaacaacctc |
51234637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 13582490 - 13582526
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaaca |
55 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13582490 |
atgcatgaccttttgaactctctgtagaaggtcaaca |
13582526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 38978926 - 38978882
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctcagg |
63 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
38978926 |
atgcatcaccttttgaactatatgtagaaggtcaacggcctcagg |
38978882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 60
Target Start/End: Complemental strand, 3443437 - 3443398
Alignment:
| Q |
21 |
gcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
3443437 |
gcatgaccctttgaactctatgtagaaggtcaacaacctc |
3443398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 54
Target Start/End: Complemental strand, 52412018 - 52411983
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaac |
54 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52412018 |
atgcatgaccctttgaactctatgtagaaggtcaac |
52411983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 21 - 55
Target Start/End: Original strand, 5338625 - 5338659
Alignment:
| Q |
21 |
gcatgaccttttgaactctatgtagaaggtcaaca |
55 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5338625 |
gcatgaccttttgaactctatgtagaatgtcaaca |
5338659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 153; Significance: 1e-80; HSPs: 10)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 1e-80
Query Start/End: Original strand, 79 - 693
Target Start/End: Original strand, 21358326 - 21358933
Alignment:
| Q |
79 |
agtctatataattactaacatgttcaggaaatggtatatgaaatttgatactgattagatgagttttgagccttcaaatgagatactaaagttgcacgct |
178 |
Q |
| |
|
||||||||| |||||||||| || || ||||| | || |||| |||| ||||| ||||||||||||||| |||| ||| || ||||||||||| | | |
|
|
| T |
21358326 |
agtctatatgattactaacaatttgagctgatggtgtgtggaattcgatagtgattggatgagttttgagccctcaactgatatgctaaagttgcatggt |
21358425 |
T |
 |
| Q |
179 |
cttttttggaatttctgtgagaactgtttttgtctacaattttatacactattctttgcgcaactaattcaaagta-aaagcacggatttgatgtatgat |
277 |
Q |
| |
|
| || || |||||||||||||||||||||||| | |||||||| |||||| || || |||| ||| ||||||| |||| | ||||||||||| | || |
|
|
| T |
21358426 |
cgttgttttaatttctgtgagaactgtttttgtttgaaattttatgcactatactgtgagcaattaaatcaaagtttaaagtaaggatttgatgtctaat |
21358525 |
T |
 |
| Q |
278 |
gtgttaggaatctgtctctattttt-tattgatattttcatgaaggtttgagtgccaaaagtggtgaacattgtatgatgttcatgctgaacattgttat |
376 |
Q |
| |
|
|| | || ||||||| ||||||||| ||| ||| |||||||||||||||||||||||||||| |||||||| |||||||||||||||| | | |
|
|
| T |
21358526 |
gtat-agaaatctgtgtctatttttgtatcgatgttttcatgaaggtttgagtgccaaaagtagtgaacat--------gttcatgctgaacattttggt |
21358616 |
T |
 |
| Q |
377 |
aaaagtcctctgttttgaattttcctagaccttttaatgatcgtttttgataaaataacattacggtgatgattcattatgtgttgctggtttgcaactt |
476 |
Q |
| |
|
||| |||||| ||| |||||||||||||| ||| ||||| |||| |||| |||||| | |||||||||||||||||| ||||||||||||||| | || |
|
|
| T |
21358617 |
aaagatcctctttttcaaattttcctagaccgtttgatgatggtttctgatgaaataaaactacggtgatgattcattacgtgttgctggtttgccattt |
21358716 |
T |
 |
| Q |
477 |
ttat-tggattttagatttaacttttggccttaacccatataggctgggtcaagtaggttggtcttgaccatactggcgactctaaatgtataacgccaa |
575 |
Q |
| |
|
|| | | | |||||||||||| |||| | | |||||||||| || |||| |||||| ||||| ||| | |||| || | |||||||||| ||| ||||| |
|
|
| T |
21358717 |
ttttattgtttttagatttaaatttttggcctaacccatatgggttggggcaagta-gttggacttcatcatattgatggctctaaatgtttaaagccaa |
21358815 |
T |
 |
| Q |
576 |
cactttgttgaggagtttaattcagtctcactattgcagcttctaaagcctaaatgcttattgaattccattttgatgtttgatttgaatttctgagaaa |
675 |
Q |
| |
|
||||||||| |||||||| ||| ||| |||| |||||| || |||||||||||| ||| || |||||||| ||||||||||||||||| ||||||| |
|
|
| T |
21358816 |
cactttgttaaggagtttcattgagtatcacagttgcagtttacaaagcctaaatgtctatcaaaatccatttttatgtttgatttgaatttttgagaaa |
21358915 |
T |
 |
| Q |
676 |
tagcttgccaatttgaaa |
693 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
21358916 |
cagccagccaatttgaaa |
21358933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 21472983 - 21473024
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21472983 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
21473024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 20259924 - 20259883
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20259924 |
atgcatgaccttttgaactctatgtagaaggtcaacaacctc |
20259883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 28041254 - 28041213
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28041254 |
atgcatgaccttttgaactctatgtagaaggtcaaccgcctc |
28041213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 2898682 - 2898723
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
2898682 |
atgcatgatcttttgaactctatgtagaaggtcaacaacctc |
2898723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 22346875 - 22346916
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
22346875 |
atgcatgaccttttgaactctgtgtagaaggtcaacaacctc |
22346916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 24177638 - 24177597
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
24177638 |
atgcatgactttttgaactctatgtagaaggtaaacagcctc |
24177597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 31737450 - 31737409
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
31737450 |
atgcatgaccttttgaactctatgtagaatgtcaatagcctc |
31737409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 4862116 - 4862080
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaaca |
55 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4862116 |
atgcatgaccctttgaactctatgtagaaggtcaaca |
4862080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 20 - 60
Target Start/End: Complemental strand, 29169919 - 29169879
Alignment:
| Q |
20 |
tgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
29169919 |
tgcatgaccttttgaactctatgtagaaggttaacaacctc |
29169879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0490 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0490
Description:
Target: scaffold0490; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 6314 - 6355
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6314 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
6355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 10)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 37514201 - 37514242
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37514201 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
37514242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 18804592 - 18804633
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18804592 |
atgcatgaccttttgaaatctatgtagaaggtcaacagcctc |
18804633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 40223530 - 40223489
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40223530 |
atgcatgaccttttgaactctatgtagaaggtcaacaacctc |
40223489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 6592555 - 6592596
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
6592555 |
atgcatgaccttttgaactctatgcagaaggtcaacaacctc |
6592596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 38815274 - 38815315
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
38815274 |
atgcatgaccctttgaactctatgtagaaggtcaacaccctc |
38815315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 500208 - 500244
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaaca |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
500208 |
atgcatgaccttttgaactctatgtagaaggccaaca |
500244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 35740113 - 35740077
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaaca |
55 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35740113 |
atgcatgactttttgaactctatgtagaaggtcaaca |
35740077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 3821204 - 3821245
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
3821204 |
atgcattaccctttgaactctatgtagaaggtcaacaacctc |
3821245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 22589463 - 22589423
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
22589463 |
atgcatgaccttttgaactctatgta-aaagtcaacagcctc |
22589423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 24125008 - 24125049
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
24125008 |
atgcatgaccttttgaactttatgtagaaggccaacaacctc |
24125049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 45804 - 45763
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45804 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
45763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 4206725 - 4206682
Alignment:
| Q |
17 |
tcatgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4206725 |
tcatgcatgaccttttgaactctatgtagaaggtcaacaacctc |
4206682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 4166051 - 4166008
Alignment:
| Q |
17 |
tcatgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
4166051 |
tcatgcatgaccttttaaactctatgtagaaggtcaacaacctc |
4166008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 317 - 356
Target Start/End: Original strand, 24745562 - 24745601
Alignment:
| Q |
317 |
tgaaggtttgagtgccaaaagtggtgaacattgtatgatg |
356 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24745562 |
tgaagggttgagtgccaaaagtggtgaacattgtatgatg |
24745601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 19 - 58
Target Start/End: Original strand, 32115698 - 32115737
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcc |
58 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32115698 |
atgcatgaccttttgaactctttgtagaaggtcaacagcc |
32115737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 28625910 - 28625951
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||| |||| |
|
|
| T |
28625910 |
atgcatgaccttttgaactttatgtagaagctcaacaacctc |
28625951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 22188782 - 22188741
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22188782 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
22188741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 38875618 - 38875659
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
38875618 |
atgcatgaccttttgaactctacgtagaaggtcagcagcctc |
38875659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 20 - 60
Target Start/End: Complemental strand, 37873764 - 37873724
Alignment:
| Q |
20 |
tgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
37873764 |
tgcatgaccctttgaactctatgtagaaggtcaacaacctc |
37873724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 60
Target Start/End: Original strand, 34335329 - 34335358
Alignment:
| Q |
31 |
ttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34335329 |
ttgaactctatgtagaaggtcaacagcctc |
34335358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 42921677 - 42921718
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||| |||| |
|
|
| T |
42921677 |
atgcatgaccttctgaactctatgtagaaggccaacaacctc |
42921718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 53170493 - 53170534
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53170493 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
53170534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 34107823 - 34107782
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34107823 |
atgcatgactttttgaactctatgtagaaggtcaacagcctc |
34107782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 60
Target Start/End: Complemental strand, 600816 - 600778
Alignment:
| Q |
22 |
catgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
600816 |
catgaccttttgaactctatgtagaaggtcaacaacctc |
600778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 60
Target Start/End: Complemental strand, 50483320 - 50483282
Alignment:
| Q |
22 |
catgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50483320 |
catgaccttttgaactctatgtagaaggtcaacaacctc |
50483282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 747896 - 747855
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
747896 |
atgcatgaccttttaaactctatgtagaaggtcaacaacctc |
747855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 16955440 - 16955473
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtca |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16955440 |
atgcatgaccttttgaactctatgtagaaggtca |
16955473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 60
Target Start/End: Original strand, 26521470 - 26521509
Alignment:
| Q |
21 |
gcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
26521470 |
gcatgaccctttgaactgtatgtagaaggtcaacagcctc |
26521509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 60
Target Start/End: Complemental strand, 56462235 - 56462192
Alignment:
| Q |
17 |
tcatgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||| |||| |
|
|
| T |
56462235 |
tcatgcatgatcctttgaactctatgtagaaggtcaacaacctc |
56462192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 712720 - 712679
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||| |||| |
|
|
| T |
712720 |
atgcatgaccttttaaactctatgtagaaggacaacaacctc |
712679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 4419243 - 4419284
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
4419243 |
atgcataaccctttgaactctatgtagaaggtcaacaacctc |
4419284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 10)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 13413331 - 13413372
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13413331 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
13413372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 41868035 - 41867994
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41868035 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
41867994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 17344618 - 17344658
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcct |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17344618 |
atgcatgaccttttgaactctatgtagaaggtcaacagcct |
17344658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 56
Target Start/End: Complemental strand, 34814945 - 34814908
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacag |
56 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34814945 |
atgcatgaccatttgaactctatgtagaaggtcaacag |
34814908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 19 - 55
Target Start/End: Complemental strand, 4413193 - 4413157
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaaca |
55 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4413193 |
atgcatgaccttttgaaccctatgtagaaggtcaaca |
4413157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 20 - 60
Target Start/End: Complemental strand, 16351970 - 16351930
Alignment:
| Q |
20 |
tgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
16351970 |
tgcatgaccatttgaactctatgtagaaggtcaacaacctc |
16351930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 19 - 59
Target Start/End: Complemental strand, 18745081 - 18745041
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcct |
59 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
18745081 |
atgcatgatcttttgaactctatgtagaaggccaacagcct |
18745041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 22 - 60
Target Start/End: Complemental strand, 9685539 - 9685501
Alignment:
| Q |
22 |
catgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
9685539 |
catgaccttttgaactctatatagaaggtccacagcctc |
9685501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 30 - 60
Target Start/End: Complemental strand, 32029202 - 32029172
Alignment:
| Q |
30 |
tttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32029202 |
tttgaactctatgtagaaggtcaacagcctc |
32029172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 19161910 - 19161869
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | ||||||| |
|
|
| T |
19161910 |
atgcatgaccttttgaactctatgtaaaaggtaagcagcctc |
19161869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0148 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 33230 - 33271
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33230 |
atgcatgaccttttgaactctatgtagaaggtcaacaacctc |
33271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000004; HSPs: 17)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 19277273 - 19277314
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19277273 |
atgcatgaccttttgaactctatgtagaaggtcaacaacctc |
19277314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 21326965 - 21326924
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21326965 |
atgcatgaccttttgaactctatgtaaaaggtcaacagcctc |
21326924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 24527569 - 24527610
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24527569 |
atgcatgaccttttgaactctatgtagaaggtcaaccgcctc |
24527610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 27521451 - 27521492
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27521451 |
atgcatgaccttttgaactctatgtagaaggtcaacaacctc |
27521492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 333 - 371
Target Start/End: Complemental strand, 40432273 - 40432235
Alignment:
| Q |
333 |
aaaagtggtgaacattgtatgatgttcatgctgaacatt |
371 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40432273 |
aaaagtggtgaaccttgtatgatgttcatgctgaacatt |
40432235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 982929 - 982970
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
982929 |
atgcatgaccttttgaactctatgtagaaggccaacaacctc |
982970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 4501239 - 4501280
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
4501239 |
atgcatgaacttttgaactctatgtagaaggtcaacaacctc |
4501280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 5972343 - 5972302
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
5972343 |
atgcatgacattttgaactctatgtagaaggtcaacaacctc |
5972302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 25187058 - 25187017
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
25187058 |
atgcatgaccttttgaactctatatagaaggtcaacaacctc |
25187017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 20 - 60
Target Start/End: Original strand, 43856855 - 43856895
Alignment:
| Q |
20 |
tgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
43856855 |
tgcatgaccctttgaactctatgtagaaggtcaacaacctc |
43856895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 619 - 692
Target Start/End: Complemental strand, 18383024 - 18382950
Alignment:
| Q |
619 |
taaagcctaaatgcttattgaattccattttg-atgtttgatttgaatttctgagaaatagcttgccaatttgaa |
692 |
Q |
| |
|
||||||||||||| |||||||||| ||||||| | ||||| | |||||||||||| || ||| | |||||||||| |
|
|
| T |
18383024 |
taaagcctaaatgtttattgaatttcattttgaaggtttggtatgaatttctgagcaagagcctaccaatttgaa |
18382950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 26 - 60
Target Start/End: Original strand, 22197973 - 22198007
Alignment:
| Q |
26 |
accttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
22197973 |
accttttgaactctatgtagaaggtcaacaacctc |
22198007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 26 - 60
Target Start/End: Complemental strand, 22239848 - 22239814
Alignment:
| Q |
26 |
accttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
22239848 |
accttttgaactctatgtagaaggtcaacaacctc |
22239814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 55
Target Start/End: Complemental strand, 9281255 - 9281222
Alignment:
| Q |
22 |
catgaccttttgaactctatgtagaaggtcaaca |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
9281255 |
catgaccctttgaactctatgtagaaggtcaaca |
9281222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 55
Target Start/End: Complemental strand, 9292226 - 9292193
Alignment:
| Q |
22 |
catgaccttttgaactctatgtagaaggtcaaca |
55 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
9292226 |
catgaccctttgaactctatgtagaaggtcaaca |
9292193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 45613969 - 45613928
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
45613969 |
atgcatgaacttttgaactctatgtagaaggctaacagcctc |
45613928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 48539161 - 48539202
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
||||||||||||||| |||||||||||| | ||||||||||| |
|
|
| T |
48539161 |
atgcatgaccttttggactctatgtagacgatcaacagcctc |
48539202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 103086 - 103127
Alignment:
| Q |
19 |
atgcatgaccttttgaactctatgtagaaggtcaacagcctc |
60 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
103086 |
atgcatgaccttttgagctcgatgtagaaggtcaacagcctc |
103127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University