View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13905_low_12 (Length: 328)

Name: NF13905_low_12
Description: NF13905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13905_low_12
NF13905_low_12
[»] chr2 (1 HSPs)
chr2 (153-219)||(10132308-10132374)


Alignment Details
Target: chr2 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 153 - 219
Target Start/End: Complemental strand, 10132374 - 10132308
Alignment:
153 gatataattaccagtatcgccgatgatgatgtatttgaaaaggtatgcgtaagacattgttgtgtgc 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10132374 gatataattaccagtatcgccgatgatgatgtatttgaaaaggtatgcgtaagacattgttgtgtgc 10132308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University