View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13905_low_15 (Length: 294)
Name: NF13905_low_15
Description: NF13905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13905_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 18 - 292
Target Start/End: Complemental strand, 36743244 - 36742970
Alignment:
| Q |
18 |
aaatatatataatgtaataagcatataatgaaaagacatatatagaggagagattatatgtgtaagtattattattactgtcagttttggtggcactgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36743244 |
aaatatatataatgtaataagcatataatgaaaagacatatatagaggagagattatatgtgtaagtattattattactgtcagttttggtggcactgat |
36743145 |
T |
 |
| Q |
118 |
caactggaggccaacactacggcctaagatagcagtagcaccatcaatgacaccaccaacaacgtctctaacaagaccaaatccagctccaagtgaaggg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36743144 |
caactggaggccaacactacggcctaagatagcagtagcaccatcaatgacaccaccaacaacgtctctaacaagaccaaatccagctccaagtgaaggg |
36743045 |
T |
 |
| Q |
218 |
ccagctttaatatcattcaaatccaatgcattcttgcacatcaacaccactgttcccttaatcctttgcttcttc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36743044 |
ccagctttaatatcattcaaatccaatgcattcttgcacatcaacaccactgttcccttaatcttttgcttcttc |
36742970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University