View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13905_low_16 (Length: 255)
Name: NF13905_low_16
Description: NF13905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13905_low_16 |
 |  |
|
| [»] scaffold0649 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0649 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: scaffold0649
Description:
Target: scaffold0649; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 71 - 236
Target Start/End: Complemental strand, 6027 - 5862
Alignment:
| Q |
71 |
ataatgtacttttcatgcttcgannnnnnnaatacgtttgtagaccaacccggtaacgaatttccaaaagggagtgaataatgtaccttgaacaatttca |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6027 |
ataatgtacttttcatgcttcggtttttttaatacgtttgtagaccaacccggtaacgaatttccaaaagggagggaataatgtaccttgaacaatttca |
5928 |
T |
 |
| Q |
171 |
tcttcatagttataataaatataagaaaaacaaaagtttattcatttcagagattgccaaactgtt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5927 |
tcttcatagttataataaatataagaaaaacaaaagtttattcatttcagagatcgccaaactgtt |
5862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0649; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 72
Target Start/End: Complemental strand, 6131 - 6074
Alignment:
| Q |
15 |
aatatccaagaattggtgtagaaataaagtaattctcacttcatgaatcattatggat |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6131 |
aatatccaagaattggtgtagaaataaagtaattctcacttcatgaatcattatggat |
6074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 12 - 72
Target Start/End: Complemental strand, 20968406 - 20968346
Alignment:
| Q |
12 |
aagaatatccaagaattggtgtagaaataaagtaattctcacttcatgaatcattatggat |
72 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20968406 |
aagaacatccaagaactggtgtagaaataaagtaattctcacttcatgaatcatcatggat |
20968346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University