View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13905_low_19 (Length: 222)
Name: NF13905_low_19
Description: NF13905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13905_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 567245 - 567438
Alignment:
| Q |
18 |
agagagacacctttgtatcatgctcaaaggttgtcagagcattacaaaagcaagaatggtgggaaagggcctgaaatatacttaaaaagagaggatctca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
567245 |
agagagacacctttgtatcatgctcaaaggttgtcagagcattacaaaagcaagaatggtgggaaagggcctgaaatatacttaaaaagagaggatctca |
567344 |
T |
 |
| Q |
118 |
accacactggctctcacaagatgaacaatgctcttgcacaagctatgattgccaagcgcatcggtctaaaaagtgtcgttacggccacaggttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
567345 |
accacactggctctcacaagatgaacaatgctcttgcacaagctatgattgccaagcgcatcggtctaaaaagtgtcgttacggccaccggttc |
567438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University