View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13908_high_8 (Length: 378)
Name: NF13908_high_8
Description: NF13908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13908_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 158 - 352
Target Start/End: Original strand, 39583495 - 39583689
Alignment:
| Q |
158 |
tagcagaaaagaagtaaaacacgccgcagttgtttccttttctattgatcaggaacttggtttgtccttcaagtactttcagtttcggtatcactatcag |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39583495 |
tagcagaaaagaagtaaaacacgccgcagttgtttccttttctattgatcaggaacttggtttgtccttcaagtactttcagtttcggtatcactatcag |
39583594 |
T |
|
| Q |
258 |
tatccgtatcactatctgtgtctgtgtcttcactttacctgtcactttcttccaaatatttcaggtaatagatacatatcaatgcagccgcagcc |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39583595 |
tatccgtatcactatctgtgtctgtgtcttcactttcactgtcactttcttccaaatatttcaggtaatagatacatatcaatgcagccgcagcc |
39583689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 39583338 - 39583427
Alignment:
| Q |
1 |
tttatggtaaatgctgtgaaaaccaatattttgaaagggaaagaaaaactagagatcagaaatgcttatattgagacttcagaagttcat |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39583338 |
tttatggtaaatgctgcgaaaaccaatattttgaaagggaaagaaaaactagagatcagaaatgcttatactgagacttcagaagttcat |
39583427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 183 - 309
Target Start/End: Complemental strand, 39627425 - 39627296
Alignment:
| Q |
183 |
gcagttgtttccttttctattgatcag---gaacttggtttgtccttcaagtactttcagtttcggtatcactatcagtatccgtatcactatctgtgtc |
279 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||| |||||||||| ||||||||| ||||| ||||| |||||||||| |||||| |||| ||||| |
|
|
| T |
39627425 |
gcagctgtttccttttctattgatcatcaagaacttgatttgtccttccagtactttccgtttctgtatcgatatcagtatctgtatcattatcagtgtc |
39627326 |
T |
|
| Q |
280 |
tgtgtcttcactttacctgtcactttcttc |
309 |
Q |
| |
|
||||||||||||| || ||||||||||| |
|
|
| T |
39627325 |
cgtgtcttcactttcactatcactttcttc |
39627296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 183 - 273
Target Start/End: Complemental strand, 39616697 - 39616604
Alignment:
| Q |
183 |
gcagttgtttccttttctattgatca---ggaacttggtttgtccttcaagtactttcagtttcggtatcactatcagtatccgtatcactatc |
273 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||| |||||||||| ||||||||||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
39616697 |
gcagctgtttccttttctattgatcatcaggaacttcatttgtccttccagtactttcagtttccgtatcaatatcagtatctgtatcactatc |
39616604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 266 - 357
Target Start/End: Complemental strand, 47532851 - 47532760
Alignment:
| Q |
266 |
tcactatctgtgtctgtgtcttcactttacctgtcactttcttccaaatatttcaggtaatagatacatatcaatgcagccgcagccgcagc |
357 |
Q |
| |
|
|||||||| || |||||| ||||||||| |||||||||||||||||| | ||||| |||||| |||||||| ||||| ||||| ||||| |
|
|
| T |
47532851 |
tcactatcagtatctgtggcttcactttcactgtcactttcttccaaaaggtacaggtcatagatgcatatcaaggcagctgcagctgcagc |
47532760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University