View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13908_low_10 (Length: 316)
Name: NF13908_low_10
Description: NF13908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13908_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 32 - 297
Target Start/End: Original strand, 45304145 - 45304396
Alignment:
| Q |
32 |
gaagtaatgcagcttttaggacccttttcatttcccaacaaattactactacaacgaaaccttttcttttcttttcttacctactatactatggtccttt |
131 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
45304145 |
gaaggaatgcagcttttaggacccttttcatttcccaacaaattactactacaacgaaaccttttcttttctt-----acctact-----atggtccttt |
45304234 |
T |
|
| Q |
132 |
cttactttcccctatacctagttactttgtgcattactgcatataagttactactttttactagttatctaannnnnnnnnnnnnnnatgcatataatca |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45304235 |
cttactttcccctatacctagttactttgtgcattgctgcatataagttactactttttactagttatctaa----tctctctctctatgcatataatca |
45304330 |
T |
|
| Q |
232 |
gtgcttagtgggtggataaagatccttatgattattattccttaaaagactttttggtgattgatt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45304331 |
gtgcttagtgggtggataaagatccttatgattattattccttaaaagactttttggtgattgatt |
45304396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University