View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13908_low_11 (Length: 296)
Name: NF13908_low_11
Description: NF13908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13908_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 769755 - 770037
Alignment:
| Q |
1 |
aggtatttcaaaagagatatatgaagtattttcagcaacaacgttgaagatagcttttgtatgtagtaaatcaaaaaagagcacgacaaaatcatagcat |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
769755 |
aggtatttcaaaagatatatatgaagtattttcagcaccaacgttgaagatagcttgtgtatgtagtaaatcaaaaaagagcatgacaaaatcatagcac |
769854 |
T |
|
| Q |
101 |
ctttctactaaaactttgcacccgagaagtccatgttaggatgctgcaaaacataaaattttgataagcaactttattaagggcttttaagataaa-aat |
199 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||| |||||||||||||| || |
|
|
| T |
769855 |
cgttctactaaaactttgcacccgagaagtccatgttaggatgctgcaaaacataaaatttagataagtgacttaattaagagcttttaagataaattat |
769954 |
T |
|
| Q |
200 |
ttatcata-aaaagtatttatatataagtacttttagaaggttatcatggagcgtttaagaagcttatagatatgtcacaagt |
281 |
Q |
| |
|
|| | || ||||||| |||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
769955 |
ttttattataaaagtacttatatataagtacttttagaaggctatcatggagagtttaagaagcttatagatatgtcacaagt |
770037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 115 - 159
Target Start/End: Complemental strand, 781338 - 781294
Alignment:
| Q |
115 |
tttgcacccgagaagtccatgttaggatgctgcaaaacataaaat |
159 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
781338 |
tttgcaccagagaagtccatgttaggatgctgcaaaacataaaat |
781294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University