View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13909_high_3 (Length: 251)

Name: NF13909_high_3
Description: NF13909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13909_high_3
NF13909_high_3
[»] chr8 (1 HSPs)
chr8 (1-235)||(13262457-13262691)


Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 13262457 - 13262691
Alignment:
1 ctattttgctgacaccggagctagcggcattgatgagaggaagaagaatggattcggattcggttagcgagaattccaccggtccaccatcgtgaagcgg 100  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13262457 ctattttgctgacgccggagctagcggcattgatgagaggaagaagaatggattcggattcggttagcgagaattccaccggtccaccatcgtgaagcgg 13262556  T
101 accgggcgtttccggttcggtatcggagggtgaaccgggaattgttctgttgtcagtgttactgagtctgtcgataatggatttgcattcgtgagcgagt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||    
13262557 accgggcgtttccggttcggtatcggagggtgaaccgggaattgttctgttgtcagtgttactgagtctgtcaatgatggatttgcattcgtgagcgagt 13262656  T
201 tttgcgtgttttcgccatgaagcgtggttgatgat 235  Q
    |||||||||||||||||||||||||||||||||||    
13262657 tttgcgtgttttcgccatgaagcgtggttgatgat 13262691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University