View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390R-Insertion-16 (Length: 258)
Name: NF1390R-Insertion-16
Description: NF1390R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390R-Insertion-16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 8 - 126
Target Start/End: Original strand, 4179598 - 4179716
Alignment:
| Q |
8 |
aaactgaatcatgggatcctcgtcttcaggctgaaagttacacgctaattgccatctttttagaagcacttacttacacggttaatagtaagaacaataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4179598 |
aaactgaatcatgggatcctcgtcttcaggctgaaagttacacgctaattgccatctttttagaagcacttacttacacggttaatagtaagaacaataa |
4179697 |
T |
|
| Q |
108 |
aacctaaaactagtaatta |
126 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4179698 |
aacctaaaactagtaatta |
4179716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 149 - 258
Target Start/End: Original strand, 4179708 - 4179815
Alignment:
| Q |
149 |
tagtaattattattttaactttgtaagttataccaaaatgtcatgttgtcacctcnnnnnnnnntttatactccaacatgtggtttgcgttgccttaatt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4179708 |
tagtaattattattttaactttgtaagttatatcaaaatgtcatgttgtcacctc--aaatttttttttactccaacatgtggtttgcgttgccttaatt |
4179805 |
T |
|
| Q |
249 |
ttgtaagttg |
258 |
Q |
| |
|
|||||||||| |
|
|
| T |
4179806 |
ttgtaagttg |
4179815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University